Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 1168285 1176875 enh97957

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 1170766 rs377476582 GCAGTGAGCCATGACTGTACCACTGCACTC G 9570103
chr7 1170766 rs545254264 GCAGTGAGCCATGACTGTACCACTGCACTC G 9570104
chr7 1170774 rs10257761 C T 9570105

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results