Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 27606905 27611175 enh50361

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 27611129 rs143526687 C T 1281078
chr10 27611140 rs549625188 G GGCTGCAGTGAGTTGTGATCGTGCC 1281079

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results