Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 28307165 28311775 enh98654

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 28309785 rs538883279 CAACTTCAAGTCGTAAATAG C 1283270

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results