Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 28779225 28796942 enh13082

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 28787325 rs112834799 A ATGTTT,ATGTTTTGTTTTGTTTTGTTTTGTTTTG 1286957

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results