Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 29084165 29093095 enh79529

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 29086245 rs148359910 CGTGGGCGGATGGCTTGAGTCCA C 1289266

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results