Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 30925125 30936555 enh13115

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 30931628 rs575511936 A ACCGTGCCCGACAGGCGTGAG 1307795
chr10 30931628 rs60698305 A ACCGTGCCCGACAGGCGTGAG 1307796
chr10 30931631 rs60428902 A ACAGGCGTGAGCCACCG,ACCG 1307797
chr10 30931631 rs7068884 A G 1307798

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results