Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 31003354 31022135 enh1158

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 31008210 rs571381782 GAATGTTGTCACACACCTAGA G 1308853

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results