Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 32286132 32296718 enh50375

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 32296137 rs567487615 CACACACCCACTAGATAACTATACAA C 1317473

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results