EnhancerDB
  1. Home
  2. TFBS
  3. SRF[chr10:93113335-93113339]
Chromosome characteristics of SRF[chr10:93113335-93113339]
Back to top
Enhancers possibly regulated by SRF[chr10:93113335-93113339]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 93097545 93115639 enh13397
Skin (Keratinocyte) Prostate (PC-3) Epithelial (MCF-7) Brain (SK-N-MC) Prostate (RWPE1) Esophagus Astrocyte Bone (Osteoblast) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Heart
SNP sites on SRF[chr10:93113335-93113339]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 93113338 rs138425680 A AATGTGTATACATATATAT,AATGTGTATACATATATATAT 1576997
Genes possibly regulated by SRF[chr10:93113335-93113339]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SRF[chr10:93113335-93113339]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results