Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 65390485 65398975 enh9820

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 65391018 rs540219265 T TTAATTATTCACCTATGGTAACATCTG 9856553

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results