Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 73221625 73228410 enh24237

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 73223978 rs559538356 TGGCCAGGGCGGGGTGGAACTGTTTTCTCTC T 9888817

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results