EnhancerDB
  1. Home
  2. TFBS
  3. ESR2[chr7:73223968-73223983]
Chromosome characteristics of ESR2[chr7:73223968-73223983]
Back to top
Enhancers possibly regulated by ESR2[chr7:73223968-73223983]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 73221625 73228410 enh24237
Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Placenta Colon (HCT116) Lung (PC-9) Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on ESR2[chr7:73223968-73223983]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 73223978 rs559538356 TGGCCAGGGCGGGGTGGAACTGTTTTCTCTC T 9888817
Genes possibly regulated by ESR2[chr7:73223968-73223983]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ESR2[chr7:73223968-73223983]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results