Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 73836745 73851629 enh40273

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 73842361 rs559288519 C CTGTCTCATATAAAAATATTTAAAACATTTTTTT 9892412

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results