Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 98411998 98426655 enh24358

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 98414884 rs545243062 GTGTCTGTGTGTGTGTCTCTGTGTA G 9975281

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results