Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 134469253 134480031 enh24541

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 134475804 rs138079998 G GCACTCTA,GCACTCTC,GCACTCTCA 10111881
chr7 134475804 rs66500104 GTGAGATACTACTTATTAAGAAA G 10111882

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results