EnhancerDB
  1. Home
  2. TFBS
  3. REST[chr13:113686026-113686045]
Chromosome characteristics of REST[chr13:113686026-113686045]
Back to top
Enhancers possibly regulated by REST[chr13:113686026-113686045]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 113685939 113686263 vista17138
VISTA
SNP sites on REST[chr13:113686026-113686045]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 113686036 rs571948518 ATGGGCCTGGCTCAAAGCTCC A 3408556
chr13 113686037 rs188729425 T C 3408557
Genes possibly regulated by REST[chr13:113686026-113686045]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by REST[chr13:113686026-113686045]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results