Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 53309329 53318845 enh62626
chr17 53315618 53315983 vista25179

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 53315665 rs536245851 CCCCGCCGCGCCCCTCTCCGCGGGT C 4938035

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results