Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 81035965 81050038 enh17462
chr17 81038687 81040054 vista26503

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 81039530 rs552311766 GAGGGGACCCCCCCACACACACACAC G 5127477

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results