EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr1:110174393-110174972]
Chromosome characteristics of TCF7L2[chr1:110174393-110174972]
Back to top
Enhancers possibly regulated by TCF7L2[chr1:110174393-110174972]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 110173365 110188215 enh61883
Cervix (HeLa-S3) Brain (SK-N-SH) Esophagus Muscle (A673) Colon (HCT116) Peripheral Blood (MM.1S) Lung (PC-9) Breast Uterus Blood (T-cell)
SNP sites on TCF7L2[chr1:110174393-110174972]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 110174850 rs545997692 GCCTGTTCCCTGTGAGGGGAACAC G 547198
chr1 110174870 rs74718089 A T 547199
chr1 110174891 rs510939 A G 547200
Genes possibly regulated by TCF7L2[chr1:110174393-110174972]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr1:110174393-110174972]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results