EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:117365916-117366938]
Chromosome characteristics of ZNF274[chr1:117365916-117366938]
Back to top
Enhancers possibly regulated by ZNF274[chr1:117365916-117366938]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 117365325 117372135 enh27102
Bone Marrow (K562) Brain (SK-N-SH) Large Intestine Blood (T-cell) Astrocyte Muscle (A673) Peripheral Blood (MM.1S) Muscle (Myoblast) Pancreas Uterus Thymus
SNP sites on ZNF274[chr1:117365916-117366938]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 117365934 rs576468264 C T 591759
chr1 117365958 rs180677137 C A 591760
chr1 117366008 rs142857950 T C 591761
chr1 117366043 rs151068018 C T 591762
chr1 117366086 rs139672230 G C 591763
chr1 117366189 rs567215031 A G 591764
chr1 117366220 rs2797422 G A 591765
chr1 117366272 rs116368068 A T 591766
chr1 117366285 rs371667341 C T 591767
chr1 117366594 rs74431266 A G 591768
chr1 117366742 rs57413157 A G 591769
chr1 117366782 rs142065281 TCAAAAGGCAAATTTAGAGC T 591770
chr1 117366782 rs58992010 TCAAAAGGCAAATTTAGAGC T 591771
chr1 117366892 rs186191224 C T 591772
Genes possibly regulated by ZNF274[chr1:117365916-117366938]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:117365916-117366938]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results