EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:156426185-156426585]
Chromosome characteristics of ZNF274[chr1:156426185-156426585]
Back to top
Enhancers possibly regulated by ZNF274[chr1:156426185-156426585]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 156419365 156433115 enh657
Bone Marrow (K562) Brain (SK-N-SH) Large Intestine Bone (Osteoblast) Blood (Karpas-422) Muscle (Myoblast) Pancreas (Panc1) Uterus
SNP sites on ZNF274[chr1:156426185-156426585]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 156426324 rs138089732 C G,T 648508
chr1 156426465 rs199607545 AG A 648509
chr1 156426574 rs532602661 T TTGGCTGATGATTCCGTCTGCCAC 648510
Genes possibly regulated by ZNF274[chr1:156426185-156426585]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:156426185-156426585]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results