EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:167635835-167638559]
Chromosome characteristics of ZNF274[chr1:167635835-167638559]
Back to top
Enhancers possibly regulated by ZNF274[chr1:167635835-167638559]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 167635443 167657337 enh718
Liver Blood (OCI-LY7) Blood (GM12878) Stomach Placenta Blood (Karpas-422) Muscle (Myoblast) Heart
chr1 167635730 167635903 vista3782
VISTA
SNP sites on ZNF274[chr1:167635835-167638559]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 167635879 rs541014098 G T 704199
chr1 167635964 rs144197622 C T 704200
chr1 167635968 rs570201215 A G 704201
chr1 167636340 rs545815429 CCATTGTAGCTGAGTAGGCTTCAAGGGAGGGGGCCGCCT C 704202
chr1 167636560 rs7542207 C T 704203
chr1 167636561 rs543225931 G A,T 704204
chr1 167636659 rs12073030 A G 704205
chr1 167636814 rs141449515 T C 704206
chr1 167637006 rs55856911 A G 704207
chr1 167637050 rs59492933 A G,T 704208
chr1 167637072 rs150776919 T C 704209
chr1 167637255 rs1229367 T A,C 704210
chr1 167637320 rs112738695 G C 704211
chr1 167637357 rs139333861 C T 704212
chr1 167637415 rs187007230 G A,T 704213
chr1 167637424 rs191753900 C A,G,T 704214
chr1 167637524 rs58844384 G A 704215
chr1 167637633 rs1229366 G A 704216
chr1 167637724 rs77849751 A T 704217
chr1 167637763 rs1229365 A G 704218
chr1 167637767 rs117089230 C A 704219
chr1 167637968 rs78121912 T C 704220
chr1 167637973 rs57523926 TA T 704221
chr1 167637973 rs781380929 TA T 704222
chr1 167637973 rs796313683 TA T 704223
chr1 167638053 rs146529653 G A 704224
chr1 167638124 rs3753924 G A 704225
chr1 167638153 rs552876951 A G 704226
chr1 167638203 rs1229364 T C 704227
chr1 167638251 rs1229363 T G 704228
chr1 167638288 rs3753927 T C 704229
chr1 167638310 rs74120619 T G 704230
chr1 167638423 rs75377693 C T 704231
chr1 167638451 rs3753928 C T 704232
chr1 167638461 rs3753929 T C 704233
chr1 167638557 rs6695906 G A 704234
Genes possibly regulated by ZNF274[chr1:167635835-167638559]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:167635835-167638559]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results