EnhancerDB
  1. Home
  2. TFBS
  3. ZNF217[chr1:168356221-168356877]
Chromosome characteristics of ZNF217[chr1:168356221-168356877]
Back to top
Enhancers possibly regulated by ZNF217[chr1:168356221-168356877]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 168352841 168381875 enh12353
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Lung (A549) Placenta Colon (HCT116) Peripheral Blood (MM.1S) Lung (PC-9) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7)
SNP sites on ZNF217[chr1:168356221-168356877]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 168356434 rs569384402 C T 708369
chr1 168356665 rs143529692 T C 708370
chr1 168356705 rs370180240 A G 708371
chr1 168356750 rs12035897 C T 708372
chr1 168356844 rs375750125 TTTATGTCTTTCCAGTTTCCTTTTTCCAAAAGG T 708373
chr1 168356875 rs78877231 G A 708374
Genes possibly regulated by ZNF217[chr1:168356221-168356877]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF217[chr1:168356221-168356877]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results