Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 182202525 182220695 enh12438

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 182205311 rs146029933 G T 773028
chr1 182205345 rs185135254 G A 773029
chr1 182205380 rs552425305 CCAGGCAATGTGGCTATGAATGGGCCTAATGAGAAT C 773030
chr1 182205396 rs571864628 T C 773031
chr1 182205415 rs10911042 T C 773032
chr1 182205426 rs556933570 G T 773033
chr1 182205430 rs117219578 G A 773034
chr1 182205474 rs79103174 A G 773035
chr1 182205482 rs139950211 T C 773036
chr1 182205484 rs190290610 C T 773037
chr1 182205489 rs553069331 C T 773038
chr1 182205554 rs182658094 C T 773039
chr1 182205555 rs116652842 G A 773040

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results