EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr1:182580961-182581221]
Chromosome characteristics of ZNF143[chr1:182580961-182581221]
Back to top
Enhancers possibly regulated by ZNF143[chr1:182580961-182581221]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 182579165 182589384 enh796
Cervix (HeLa-S3) Brain (SK-N-SH) Prostate (RWPE1) Blood (T-cell) Esophagus Astrocyte Lung (PC-9) Bone (Osteoblast) Blood (OCI-LY7) Blood (GM12878) Muscle (A673) Blood (Karpas-422) Muscle (Myoblast) Pancreas Embryonic Stem Cell Line (H1-hESC) Uterus Thymus Heart
SNP sites on ZNF143[chr1:182580961-182581221]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 182580988 rs187369831 G A 775425
chr1 182581023 rs12402015 G A 775426
chr1 182581037 rs73061356 G A,T 775427
chr1 182581157 rs34085461 T A,G 775428
chr1 182581171 rs572733494 AGATAGAAATGAGCTCTCCCTAATAGGCCCCACACATTTGAGCAG A 775429
chr1 182581196 rs551641408 G A 775430
chr1 182581215 rs573159589 G GA 775431
Genes possibly regulated by ZNF143[chr1:182580961-182581221]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr1:182580961-182581221]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results