EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr1:183133442-183133982]
Chromosome characteristics of ZBTB33[chr1:183133442-183133982]
Back to top
Enhancers possibly regulated by ZBTB33[chr1:183133442-183133982]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 183125041 183136908 enh12446
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Astrocyte Lung (A549) Placenta Colon (HCT116) Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Epithelial (MCF-7)
chr1 183133608 183133779 vista4155
VISTA
SNP sites on ZBTB33[chr1:183133442-183133982]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 183133468 rs554187117 TTTTTAAGAATCTTCACCACAATTACA T 778575
chr1 183133500 rs143930333 G A 778576
chr1 183133522 rs146873548 T C 778577
chr1 183133525 rs148564386 G A,C 778578
chr1 183133621 rs542593952 C T 778579
chr1 183133693 rs527924568 C A 778580
chr1 183133694 rs73038744 T A 778581
chr1 183133773 rs73038746 T C 778582
chr1 183133827 rs77939842 T G 778583
chr1 183133937 rs73038749 G A 778584
Genes possibly regulated by ZBTB33[chr1:183133442-183133982]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr1:183133442-183133982]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results