EnhancerDB
  1. Home
  2. TFBS
  3. FLI1[chr1:201450639-201451541]
Chromosome characteristics of FLI1[chr1:201450639-201451541]
Back to top
Enhancers possibly regulated by FLI1[chr1:201450639-201451541]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 201440605 201452315 enh876
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Bone (Osteoblast) Muscle (A673) Placenta Blood (Karpas-422) Pancreas Thymus
SNP sites on FLI1[chr1:201450639-201451541]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 201450682 rs112680326 C T 854083
chr1 201450683 rs548445278 GGGCGGGGTGGCTTATGCCTGTAATCCCAGCCACTCAGAGGCTGAGCCA G 854084
chr1 201450708 rs139422906 C A 854085
chr1 201450731 rs541631691 A G 854086
chr1 201450767 rs12402783 T G 854087
chr1 201450913 rs147149844 C T 854088
chr1 201450989 rs78601627 G A 854089
chr1 201451096 rs185403027 C T 854090
chr1 201451130 rs144358580 C T 854091
chr1 201451146 rs116113145 C T 854092
chr1 201451151 rs558183582 T C 854093
chr1 201451163 rs144056716 TCTGG T 854094
chr1 201451223 rs145512584 C T 854095
chr1 201451313 rs146472105 G A,C 854096
chr1 201451396 rs575077311 T A 854097
chr1 201451427 rs142623780 T G 854098
chr1 201451484 rs372321246 T C,G 854099
Genes possibly regulated by FLI1[chr1:201450639-201451541]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FLI1[chr1:201450639-201451541]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results