EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr1:203884877-203885417]
Chromosome characteristics of ZBTB33[chr1:203884877-203885417]
Back to top
Enhancers possibly regulated by ZBTB33[chr1:203884877-203885417]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 203881465 203891816 enh12569
Prostate (PC-3) Cervix (HeLa-S3) Lung (A549) Placenta Lung (PC-9) Pancreas (Panc1) Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on ZBTB33[chr1:203884877-203885417]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 203884882 rs115745889 G T 872127
chr1 203884915 rs11584733 A G 872128
chr1 203884967 rs375881596 A G 872129
chr1 203884968 rs2796389 C T 872130
chr1 203885012 rs553220160 C G 872131
chr1 203885278 rs371766586 ATTTTGTACCCTTCTGATAAAATCT A 872132
chr1 203885278 rs557469318 ATTTTGTACCCTTCTGATAAAATCT A 872133
chr1 203885316 rs115466309 T C 872134
chr1 203885317 rs116116993 A C 872135
chr1 203885370 rs182726148 T C 872136
chr1 203885375 rs56159329 C T 872137
Genes possibly regulated by ZBTB33[chr1:203884877-203885417]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr1:203884877-203885417]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results