Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 204466245 204479448 enh886

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 204469314 rs12036042 T C 876790
chr1 204469576 rs143697073 GGGACAGAAGAGGAGGGCAAC G 876791
chr1 204469576 rs370369548 GGGACAGAAGAGGAGGGCAAC G 876792
chr1 204469608 rs182517708 G A 876793

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results