EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:204680203-204681087]
Chromosome characteristics of ZNF274[chr1:204680203-204681087]
Back to top
Enhancers possibly regulated by ZNF274[chr1:204680203-204681087]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 204671389 204688135 enh890
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Blood (OCI-LY7) Placenta Peripheral Blood (MM.1S) Blood (Karpas-422) Lung (PC-9) Thymus Epithelial (MCF-7)
SNP sites on ZNF274[chr1:204680203-204681087]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 204680217 rs115765204 T C 878418
chr1 204680223 rs74138539 G A,C 878419
chr1 204680272 rs540941985 C T 878420
chr1 204680295 rs548371408 T C 878421
chr1 204680302 rs74610830 G A 878422
chr1 204680313 rs74138540 T G 878423
chr1 204680332 rs944079 C T 878424
chr1 204680333 rs114325149 G A,C 878425
chr1 204680398 rs117401993 C A,G,T 878426
chr1 204680490 rs10793717 C G,T 878427
chr1 204680496 rs142879077 C T 878428
chr1 204680577 rs6696501 C T 878429
chr1 204680586 rs113095807 C A,T 878430
chr1 204680701 rs12133037 C T 878431
chr1 204680802 rs193198509 C G 878432
chr1 204680817 rs116439622 T C 878433
chr1 204680855 rs6696790 C T 878434
chr1 204680870 rs577989796 T TCATCCCTATACCCCACAAA 878435
chr1 204680879 rs145703406 T C 878436
chr1 204680936 rs77801372 A G 878437
chr1 204680937 rs78939737 C A 878438
chr1 204680997 rs6696899 C G 878439
chr1 204681009 rs74138541 G A 878440
chr1 204681010 rs10900424 C T 878441
chr1 204681055 rs138431027 C T 878442
chr1 204681064 rs115596595 T C 878443
chr1 204681068 rs12037418 C G,T 878444
chr1 204681081 rs141336679 C A,T 878445
Genes possibly regulated by ZNF274[chr1:204680203-204681087]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:204680203-204681087]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results