EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr1:205512975-205513265]
Chromosome characteristics of ZZZ3[chr1:205512975-205513265]
Back to top
Enhancers possibly regulated by ZZZ3[chr1:205512975-205513265]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 205502445 205516735 enh12593
Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Large Intestine Prostate (RWPE1) Astrocyte Lung Stomach Placenta Lung (PC-9) Pancreas Heart
SNP sites on ZZZ3[chr1:205512975-205513265]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 205513100 rs367813412 T A 884464
chr1 205513131 rs6679702 C A,T 884465
chr1 205513182 rs6694713 T A 884466
chr1 205513188 rs11273569 T TTTACAACACCTGACCCCAACTTGGGACTTGGGATGGC 884467
Genes possibly regulated by ZZZ3[chr1:205512975-205513265]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr1:205512975-205513265]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results