Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 207183676 rs147768871 T TCTTTTCTTTTGCTCTCTCA 892643
chr1 207183676 rs57683870 T TCTTTTCTTTTGCTCTCTCA 892644
chr1 207183747 rs12407964 G T 892645
chr1 207183776 rs11120048 T C 892646
chr1 207183810 rs78838116 C G,T 892647
chr1 207183903 rs549599574 T C 892648
chr1 207183937 rs12408211 G A 892649
chr1 207183947 rs12408214 G A 892650
chr1 207184025 rs571592496 C T 892651

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results