EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:211517091-211517539]
Chromosome characteristics of ZNF274[chr1:211517091-211517539]
Back to top
Enhancers possibly regulated by ZNF274[chr1:211517091-211517539]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 211498150 211519175 enh904
Cervix (HeLa-S3) Large Intestine Blood (T-cell) Esophagus Bone (Osteoblast) Blood (OCI-LY7) Blood (GM12878) Stomach Peripheral Blood (MM.1S) Blood (Karpas-422) Pancreas Muscle (Myotube) Thymus Epithelial (MCF-7)
chr1 211517513 211517976 vista4959
VISTA
SNP sites on ZNF274[chr1:211517091-211517539]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 211517202 rs2280079 G A 915484
chr1 211517254 rs6672233 A G 915485
chr1 211517258 rs544039126 GGGCTTCCTAGTGGAGAACAA G 915486
chr1 211517330 rs114635538 T G 915487
Genes possibly regulated by ZNF274[chr1:211517091-211517539]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:211517091-211517539]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results