EnhancerDB
  1. Home
  2. TFBS
  3. ZNF217[chr1:217542858-217543328]
Chromosome characteristics of ZNF217[chr1:217542858-217543328]
Back to top
Enhancers possibly regulated by ZNF217[chr1:217542858-217543328]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 217534560 217549895 enh925
Cervix (HeLa-S3) Neural Stem Cells (H9) Blood (Karpas-422) Epithelial (MCF-7)
SNP sites on ZNF217[chr1:217542858-217543328]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 217542866 rs2810779 G A 944378
chr1 217542933 rs6143624 G GAAAACACTTACCATTAAAAAAA 944379
chr1 217543044 rs557577462 G A,C 944380
chr1 217543076 rs543536827 T C 944381
chr1 217543086 rs17046174 A G 944382
chr1 217543239 rs2815237 T C 944383
chr1 217543240 rs12407216 T C,G 944384
Genes possibly regulated by ZNF217[chr1:217542858-217543328]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF217[chr1:217542858-217543328]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results