Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 25366025 25375095 enh27925

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 25371422 rs151247130 C G 1273807
chr10 25371453 rs140460716 T C 1273808
chr10 25371556 rs12264258 T C 1273809
chr10 25371718 rs543690702 G C 1273810
chr10 25371749 rs729141 T C 1273811
chr10 25371777 rs117344517 A G 1273812
chr10 25371781 rs78728161 G A 1273813
chr10 25371799 rs115326268 C T 1273814
chr10 25371829 rs12241589 G A 1273815
chr10 25371871 rs12256751 C T 1273816
chr10 25371930 rs192143209 C T 1273817
chr10 25372000 rs570553168 T TTTGAGTAGGGATGAGGGTGCA 1273818

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results