EnhancerDB
  1. Home
  2. TFBS
  3. ZNF217[chr10:28974047-28974617]
Chromosome characteristics of ZNF217[chr10:28974047-28974617]
Back to top
Enhancers possibly regulated by ZNF217[chr10:28974047-28974617]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 28971831 28980635 enh67458
Prostate (PC-3) Muscle (A673) Lung (PC-9) Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on ZNF217[chr10:28974047-28974617]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 28974048 rs530006311 C T 1288187
chr10 28974087 rs141891806 CCT C 1288188
chr10 28974087 rs867167786 CCT C 1288189
chr10 28974090 rs373686833 C T 1288190
chr10 28974104 rs187114868 A G 1288191
chr10 28974123 rs75509350 C T 1288192
chr10 28974131 rs572129370 C T 1288193
chr10 28974360 rs76862427 G A 1288194
chr10 28974528 rs148094179 C T 1288195
chr10 28974538 rs564816992 T TGAAAAAATTGATCTGTGCATGGTTATGTCTTTTA 1288196
chr10 28974607 rs141874412 A G 1288197
Genes possibly regulated by ZNF217[chr10:28974047-28974617]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF217[chr10:28974047-28974617]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results