EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr10:31007459-31008210]
Chromosome characteristics of ZNF274[chr10:31007459-31008210]
Back to top
Enhancers possibly regulated by ZNF274[chr10:31007459-31008210]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 31003354 31022135 enh1158
Brain (SK-N-SH) Blood (OCI-LY7) Blood (GM12878) Placenta Blood (Karpas-422) Muscle (Myotube) Uterus Epithelial (MCF-7)
SNP sites on ZNF274[chr10:31007459-31008210]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 31007459 rs12258038 C T 1308838
chr10 31007460 rs143150061 G A 1308839
chr10 31007687 rs147480025 C T 1308840
chr10 31007726 rs35351259 C CT 1308841
chr10 31007727 rs60413549 T TT,TTA,TTAA 1308842
chr10 31007796 rs377418258 TATATGTTCTTAAA T 1308843
chr10 31007796 rs556253762 TATATGTTCTTAAA T 1308844
chr10 31007813 rs77708892 C T 1308845
chr10 31007845 rs78357413 C G 1308846
chr10 31007904 rs11008205 G A 1308847
chr10 31007961 rs76477221 C G 1308848
chr10 31007972 rs78386373 C A,T 1308849
chr10 31008080 rs76841754 G A 1308850
chr10 31008094 rs4749597 A T 1308851
chr10 31008138 rs72812523 T C 1308852
chr10 31008210 rs571381782 GAATGTTGTCACACACCTAGA G 1308853
Genes possibly regulated by ZNF274[chr10:31007459-31008210]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr10:31007459-31008210]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results