EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr10:31008031-31008397]
Chromosome characteristics of ZBTB33[chr10:31008031-31008397]
Back to top
Enhancers possibly regulated by ZBTB33[chr10:31008031-31008397]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 31003354 31022135 enh1158
Brain (SK-N-SH) Blood (OCI-LY7) Blood (GM12878) Placenta Blood (Karpas-422) Muscle (Myotube) Uterus Epithelial (MCF-7)
SNP sites on ZBTB33[chr10:31008031-31008397]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 31008080 rs76841754 G A 1308850
chr10 31008094 rs4749597 A T 1308851
chr10 31008138 rs72812523 T C 1308852
chr10 31008210 rs571381782 GAATGTTGTCACACACCTAGA G 1308853
chr10 31008315 rs139179176 C T 1308854
Genes possibly regulated by ZBTB33[chr10:31008031-31008397]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr10:31008031-31008397]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results