EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr11:1050536-1052047]
Chromosome characteristics of ZNF143[chr11:1050536-1052047]
Back to top
Enhancers possibly regulated by ZNF143[chr11:1050536-1052047]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 1046865 1057035 enh57572
Prostate (PC-3) Cervix (HeLa-S3) Lung (A549) Stomach Muscle (A673) Pancreas Epithelial (MCF-7)
SNP sites on ZNF143[chr11:1050536-1052047]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 1050551 rs184623130 C T 1790773
chr11 1050669 rs189512939 C G,T 1790774
chr11 1050696 rs115488011 G A,T 1790775
chr11 1050719 rs74330548 C T 1790776
chr11 1050889 rs562177343 C T 1790777
chr11 1050905 rs114876717 C G 1790778
chr11 1050910 rs144568905 C T 1790779
chr11 1050916 rs148979686 C CGGCTCACACTCG 1790780
chr11 1050916 rs368575914 C CGGCTCACACTCG 1790781
chr11 1051109 rs189255210 G A 1790782
chr11 1051159 rs73405223 C T 1790783
chr11 1051279 rs568544631 G T 1790784
chr11 1051291 rs114740155 C T 1790785
chr11 1051363 rs117767009 G T 1790786
chr11 1051439 rs143778454 TC T 1790787
chr11 1051493 rs181147432 G A 1790788
chr11 1051500 rs61869022 T C 1790789
chr11 1051630 rs139912811 G A 1790790
chr11 1051657 rs145622139 A AC 1790791
chr11 1051657 rs34698395 AC A 1790792
chr11 1051657 rs760946454 A AC 1790793
chr11 1051657 rs796471556 AC A 1790794
chr11 1051715 rs10794359 T C 1790795
chr11 1051734 rs150004945 C T 1790796
chr11 1051776 rs138234754 TCCCCTGGCACCTGGGAAGCTGGGC T 1790797
chr11 1051780 rs534779475 CT C 1790798
chr11 1051966 rs574073953 A G,T 1790799
Genes possibly regulated by ZNF143[chr11:1050536-1052047]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr11:1050536-1052047]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results