EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr11:10302485-10305888]
Chromosome characteristics of ZNF274[chr11:10302485-10305888]
Back to top
Enhancers possibly regulated by ZNF274[chr11:10302485-10305888]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 10301705 10312675 enh50706
Liver (HepG2) Brain (SK-N-MC) Large Intestine Esophagus Stomach Lung (PC-9) Epithelial (MCF-7)
chr11 10302186 10302573 vista9600
VISTA
SNP sites on ZNF274[chr11:10302485-10305888]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 10302538 rs16907632 C T 1839604
chr11 10302555 rs537472456 T C 1839605
chr11 10302711 rs55771749 T C 1839606
chr11 10302874 rs59651099 C T 1839607
chr11 10302921 rs61889838 C T 1839608
chr11 10303177 rs16907635 T C 1839609
chr11 10303201 rs369550475 T G 1839610
chr11 10303278 rs372923284 ACCCAGT A 1839611
chr11 10303278 rs527881825 ACCCAGT A 1839612
chr11 10303432 rs114460019 C T 1839613
chr11 10303708 rs555464039 T A 1839614
chr11 10303725 rs116489921 A G 1839615
chr11 10303746 rs115927828 T C 1839616
chr11 10303747 rs144876349 T C 1839617
chr11 10303939 rs11042717 T C 1839618
chr11 10304045 rs61889840 C T 1839619
chr11 10304248 rs115992830 A G 1839620
chr11 10304271 rs540812453 T C 1839621
chr11 10304359 rs67832114 CCACCATCTATAGAGTCAAGGCT C 1839622
chr11 10304359 rs796340610 CCACCATCTATAGAGTCAAGGCT C 1839623
chr11 10304895 rs397748787 G GT 1839624
chr11 10304895 rs59228043 G GT 1839625
chr11 10304938 rs74884264 T C 1839626
chr11 10304992 rs59709366 C G 1839627
chr11 10305005 rs58340019 C T 1839628
chr11 10305049 rs186156350 C T 1839629
chr11 10305095 rs7947666 A T 1839630
chr11 10305173 rs369809145 TA T 1839631
chr11 10305269 rs563034735 T C 1839632
chr11 10305287 rs572948918 T G 1839633
chr11 10305368 rs140311012 T G 1839634
chr11 10305443 rs191496612 A C 1839635
chr11 10305770 rs12273035 A G 1839636
chr11 10305805 rs182896455 T C 1839637
chr11 10305810 rs59871004 A G 1839638
Genes possibly regulated by ZNF274[chr11:10302485-10305888]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr11:10302485-10305888]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results