Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 12217885 12225194 enh13778
chr11 12222498 12222995 vista9688

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 12222292 rs537837340 GTTTAGCCAAGAGAATCAGAAACTGTA G 1855095
chr11 12222313 rs139570850 A G 1855096
chr11 12222345 rs2013262 G A 1855097
chr11 12222359 rs562021476 T C 1855098
chr11 12222423 rs869123 A G 1855099
chr11 12222430 rs142874635 T C 1855100
chr11 12222561 rs114239583 C T 1855101
chr11 12222624 rs117195299 C T 1855102
chr11 12222692 rs61875234 C T 1855103
chr11 12222728 rs575153769 C A,G 1855104

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results