Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 59321752 59337039 enh1799

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 59333437 rs145654606 C G 2017084
chr11 59333516 rs555634503 C T 2017085
chr11 59333524 rs138479587 C G 2017086
chr11 59333774 rs374163733 TGACCCTGTTAACTGCAGAAA T 2017087
chr11 59333774 rs547576244 TGACCCTGTTAACTGCAGAAA T 2017088

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results