Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 59321752 59337039 enh1799

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 59333774 rs374163733 TGACCCTGTTAACTGCAGAAA T 2017087
chr11 59333774 rs547576244 TGACCCTGTTAACTGCAGAAA T 2017088
chr11 59333808 rs552425270 G A 2017089
chr11 59333836 rs143100234 G A 2017090
chr11 59333844 rs138892768 C T 2017091
chr11 59333886 rs557009559 G A,C,T 2017092

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results