EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr11:59333582-59333835]
Chromosome characteristics of ZZZ3[chr11:59333582-59333835]
Back to top
Enhancers possibly regulated by ZZZ3[chr11:59333582-59333835]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 59321752 59337039 enh1799
Cervix (HeLa-S3) Prostate (RWPE1) Bone (Osteoblast) Blood (GM12878) Colon (HCT116) Blood (Karpas-422) Pancreas Pancreas (Panc1) Uterus Blood (T-cell)
SNP sites on ZZZ3[chr11:59333582-59333835]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 59333774 rs374163733 TGACCCTGTTAACTGCAGAAA T 2017087
chr11 59333774 rs547576244 TGACCCTGTTAACTGCAGAAA T 2017088
chr11 59333808 rs552425270 G A 2017089
Genes possibly regulated by ZZZ3[chr11:59333582-59333835]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr11:59333582-59333835]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results