Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 61259765 61269815 enh13956
chr11 61266317 61266637 vista10451

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 61266625 rs58091965 C A,G,T 2024433
chr11 61266627 rs186443180 G C 2024434
chr11 61266747 rs35795821 A ATTG 2024435
chr11 61266749 rs34057719 C T 2024436
chr11 61266818 rs541912065 T TTCATAAGCAATACTCAAGACCTCAAAAGTGTA 2024437
chr11 61266827 rs11230719 A C 2024438
chr11 61266903 rs76395439 C T 2024439

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results