Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 63534605 63549275 enh13982

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 63534182 rs146519528 C A 2035413
chr11 63534205 rs568543125 CGGGACCCACCCACCTGGGGCCCCCGCCAGGA C 2035414
chr11 63534209 rs532655579 A C 2035415
chr11 63534299 rs182590489 T G 2035416
chr11 63534596 rs61928237 G T 2035417
chr11 63534598 rs539160500 G A 2035418
chr11 63534659 rs540006394 A G 2035419

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results