EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr11:63837088-63839643]
Chromosome characteristics of ZNF274[chr11:63837088-63839643]
Back to top
Enhancers possibly regulated by ZNF274[chr11:63837088-63839643]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 63829799 63865183 enh28836
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-MC) Prostate (RWPE1) Lung (PC-9) Esophagus Astrocyte Brain (SK-N-SH) Bone (Osteoblast) Stomach Muscle (A673) Thyroid Muscle (Myoblast) Pancreas Pancreas (Panc1) Muscle (Myotube) Thymus Epithelial (MCF-7)
chr11 63837811 63837961 vista10554
VISTA
SNP sites on ZNF274[chr11:63837088-63839643]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 63837198 rs377393455 G C 2037698
chr11 63837207 rs551062377 C T 2037699
chr11 63837279 rs536124449 G A,C 2037700
chr11 63837502 rs529203548 C T 2037701
chr11 63837620 rs116545445 G A 2037702
chr11 63837783 rs181768857 A G 2037703
chr11 63837882 rs151282695 G A 2037704
chr11 63837999 rs55966765 C T 2037705
chr11 63838010 rs139299981 C T 2037706
chr11 63838013 rs144235418 G A 2037707
chr11 63838058 rs190124483 C G 2037708
chr11 63838112 rs146547511 C G,T 2037709
chr11 63838144 rs113356862 C T 2037710
chr11 63838144 rs558799489 C CG 2037711
chr11 63838287 rs185139591 A G 2037712
chr11 63838306 rs74753444 C G,T 2037713
chr11 63838320 rs12360719 G A 2037714
chr11 63838452 rs34445666 G A 2037715
chr11 63838457 rs76575138 A C 2037716
chr11 63838480 rs115384268 C T 2037717
chr11 63838591 rs182693072 T C 2037718
chr11 63838641 rs76233005 T A 2037719
chr11 63838923 rs556506312 A AGGGCTG 2037720
chr11 63838944 rs116934404 C A 2037721
chr11 63839010 rs116047050 G A 2037722
chr11 63839035 rs114860191 A G 2037723
chr11 63839136 rs556422136 C T 2037724
chr11 63839295 rs80231682 G A 2037725
chr11 63839339 rs577967061 T C 2037726
chr11 63839494 rs193116554 C T 2037727
chr11 63839506 rs9783361 C T 2037728
chr11 63839511 rs183559194 C T 2037729
chr11 63839512 rs571677740 G A 2037730
chr11 63839514 rs560578143 GCACTAAATCCTCCCGGCAGACAA G 2037731
chr11 63839611 rs547416395 G A,T 2037732
Genes possibly regulated by ZNF274[chr11:63837088-63839643]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr11:63837088-63839643]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results