Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 65691605 65703755 enh47496

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 65693786 rs530822904 G T 2049730
chr11 65693896 rs190109068 G A 2049731
chr11 65693957 rs9795173 A G 2049732
chr11 65694056 rs10609752 ATG A 2049733
chr11 65694056 rs201230904 ATG A 2049734
chr11 65694086 rs144373328 A G 2049735
chr11 65694106 rs576549999 G GTGTATATATATGTACACACATATATATA 2049736
chr11 65694110 rs184701829 A G 2049737
chr11 65694125 rs549093678 C CAT 2049738
chr11 65694134 rs571852424 A ATG 2049739

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results