EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr11:71854983-71855393]
Chromosome characteristics of ZBTB33[chr11:71854983-71855393]
Back to top
Enhancers possibly regulated by ZBTB33[chr11:71854983-71855393]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 71845725 71861715 enh14060
Skin (Keratinocyte) Cervix (HeLa-S3) Prostate (RWPE1) Astrocyte Bone (Osteoblast) Lung (A549) Placenta Thyroid Lung (PC-9) Muscle (Myoblast) Epithelial (MCF-7)
SNP sites on ZBTB33[chr11:71854983-71855393]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 71855120 rs535832092 G A 2091969
chr11 71855171 rs554334307 T C 2091970
chr11 71855392 rs533604294 ACAATATAAAGATTTATAGGC A 2091971
Genes possibly regulated by ZBTB33[chr11:71854983-71855393]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr11:71854983-71855393]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results