EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr11:121112591-121112886]
Chromosome characteristics of ZBTB33[chr11:121112591-121112886]
Back to top
Enhancers possibly regulated by ZBTB33[chr11:121112591-121112886]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 121104764 121114984 enh29200
Prostate (PC-3) Brain (SK-N-SH) Esophagus Astrocyte Blood (OCI-LY7) Blood (GM12878) Muscle (A673) Muscle (Myoblast) Neural Stem Cells (H9)
SNP sites on ZBTB33[chr11:121112591-121112886]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 121112712 rs75241432 C T 2315346
chr11 121112739 rs188760367 C T 2315347
chr11 121112750 rs550149333 A AGCCCCTCTTTGGGTGGCTGCAGCG 2315348
chr11 121112765 rs10892694 G A 2315349
chr11 121112765 rs142470026 G GGCTGCAGCGGCCCCTCTTTGGGTA,GGCTGCAGCGGCCCCTCTTTGGGTGGCTGCAGCGGCCCCTCTTTGGGTA 2315350
chr11 121112765 rs370900544 G GGCTGCAGCGGCCCCTCTTTGGGTA 2315351
chr11 121112815 rs529836324 C G,T 2315352
Genes possibly regulated by ZBTB33[chr11:121112591-121112886]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr11:121112591-121112886]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results