Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 126014745 126039693 enh2087

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 126029843 rs76438528 C T 2344466
chr11 126029848 rs12573975 C G 2344467
chr11 126029916 rs563646151 C T 2344468
chr11 126029917 rs485150 T C 2344469
chr11 126029923 rs549574611 C T 2344470
chr11 126029983 rs527423223 C T 2344471
chr11 126030018 rs116020384 T C 2344472
chr11 126030029 rs183950885 T C,G 2344473
chr11 126030059 rs114837979 G A 2344474
chr11 126030115 rs188946165 C T 2344475
chr11 126030128 rs553670346 GGGCAGGGGTCTCTTTCAGGCCTGTTGAT G 2344476

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results